MET Exon 14 skipping

[inodb]

Example, one gets annotated and the other doesn't

• 7,116411875,116411894,CAAGCTCTTTCTTTCTCTCT,C (no oncokb annotation)
• 7,116411874,116411895,ACAAGCTCTTTCTTTCTCTCTG,A (onckb annotation)

Some potential solutions:

• Short term. In OncoKB include deletions of splice_polyrimidine_tract_variant around protein position 963 as well
• Long term. Manage this MET splice logic in REVUE, so we can group all of these together as “MET exon 14 skipping” and OncoKB doesn’t have to worry about it