PepQueryMHC

---

• About
• Usage
  • Quick start
  • Parameters
  • Scan mode
  • Target mode
  • FASTQ mode
  • Annotate mode
  • White list
• Output
  • scan.tsv
  • target.tsv
  • gloc.tsv
  • peptide.tsv
  • annotate.tsv
• Figures for the reviewers
• License

---

About

The accurate prioritization of tumor antigens, including aberrant translational products, is critical for the development of personalized cancer immunotherapies. PepQueryMHC estimates a comprehensive repertoire of local RNA expression of tumor antigens within minutes per sample.

Usage

PepQueryMHC provides three main functions such as 1) scan mode, 2) target mode 3) FASTQ mode and 4) annotate mode.
When you use FASTQ mode, please make sure that FASTQ files do not contain artifical sequences such as adaptors, barcodes and so on.

Quick start

Scan mode

java -Xmx2G -jar PepQueryMHC.jar \
--mode scan \
--input peptides.tsv \
--bam sample.sorted.bam \
--output sample \
--thread 16

Target mode

java -Xmx2G -jar PepQueryMHC.jar \
--mode target \
--input peptides_locations_strands.tsv \
--bam sample.sorted.bam \
--output sample \
--thread 16

FASTQ mode (for single-end)

java -Xmx2G -jar PepQueryMHC.jar \
--mode fastq \
--input peptides.tsv \
--0 sample.trimmed.fastq.gz \
--output sample \
--strand f \
--thread 16

FASTQ mode (for paired-end)

java -Xmx2G -jar PepQueryMHC.jar \
--mode fastq \
--input peptides.tsv \
--1 sample.trimmed.fastq.1.gz \
--2 sample.trimmed.fastq.2.gz \
--output sample \
--strand rf \
--thread 16

Annotate mode

java -Xmx2G -jar PepQueryMHC.jar \
--mode annotate \
--input locations_strands.tsv \
--gtf reference_annotation.gtf \
--output sample

Parameters

Y+: mandatory, Y: optional, N: none

Option	Description	Type	Default	Scan mode	Target mode	FASTQ mode	Annotate mode
m/mode	mode to use	scan|target|fastq|annotate		Y+	Y+	Y+	Y+
i/input	input file path	string		Y+	Y+	Y+	Y+
o/output	output base name path	string		Y+	Y+	Y+	Y+
b/bam	sorted bam/sam file path	bam|sam		Y+	Y+	N	N
0/fastq_single	fastq file path	fastq|fastq.gz		N	N	Y+	N
1/fastq_paired_1	fastq file path	fastq|fastq.gz		N	N	Y+	N
2/fastq_paried_2	fastq file path	fastq|fastq.gz		N	N	Y+	N
g/gtf	gtf file path	string		N	N	N	Y+
@/thread	the number of threads	int	4	Y	Y	Y	N
c/count	tpye of reads being processed	primary|all	primary	Y	Y	N	N
l/lib_size	tsv file including library size information	string		Y	Y	Y	N
w/white_list	cell brcode list (tsv), only available in single-cell RNA-seq	string		Y	Y	Y	N
p/prob	ignore region of interests with error > p	[0,1]	0.05	Y	Y	Y	N
e/equal	specify isoleucine = leucine	none		Y	Y	Y	N
u/union	specify the unit of the peptide read count	sum|max	sum	Y	Y	N	N
s/strand	specify strandedness. non: non-stranded, fr: fr-second strand, rf: fr-first strand, f: forward strand for single-end, r: reverse strand for single-end, auto: auto-detection. Auto-detection is only available if there is XS tag in a given bam file	non|fr|rf|f|r|auto	auto	Y	Y	Y+	N
s/stretch	output single line per annotation	none		N	N	N	Y
v/verbose	print every messages being processed	none		Y	Y	Y	Y

Scan mode

Input format

Sequence	User-defined column 1	...	User-defined column N
AACTKLAKKM	any value	...	any value

Target mode

Input format

Sequence	Location	Strand	User-defined column 1	...	User-defined column N
AACTKLAKKM	chr1:1-30	+	any value	...	any value
TKMQEPPALY	chr1:31-50|chr1:81-90	-	any value	...	any value
KEKRKAPPR	.	.	any value	...	any value

FASTQ mode

Input format

Sequence	User-defined column 1	...	User-defined column N
AACTKLAKKM	any value	...	any value

• input format is exactly the same as what used in scan mode.

Annotate mode

Input format

Location	Strand	User-defined column 1	...	User-defined column N
chr1:1-30	+	any value	...	any value
chr1:31-50|chr1:81-90	-	any value	...	any value
chr1:21-40|chr1:87-90	.	any value	...	any value

White list

A white list is a set of barcodes selected for inclusion in the analysis of single-cell RNA-seq data.
Input format

Barcode
AAACCTGAGCAATCTC-1
AAACCTGAGCGTTTAC-1
AAACCTGAGCTGCAAG-1
AAACCTGCAAACGTGG-1
AAACCTGCAAACTGCT-1
AAACCTGCAACTGGCC-1
AAACCTGCAAGCCCAC-1
AAACCTGCACTTAAGC-1
AAACCTGCAGCCACCA-1

Output

PepQueryMHC provides four modes (scan, fastq, target, and annotate modes) and generates different levels of transcriptomic annotations.

scan.tsv

This format is generated in both scan and fastq modes and contains detailed level of transcriptomic features.

Column	Description	Example	Scan mode	FASTQ mode
Matched_location	Matched genomic location	chr16:84101848-84101874	Y	N
Matched_mutations	Nucleotide variants including SNV and INDEL	chr16:84101848A>T	Y	N
Matched_strand	RNA strand	-	Y	N
Matched_peptide	Translated nucleotide sequence directly from the input NGS	LLAETKIHL	Y	Y
Matched_nucleotide	Nucleotide sequence directly from the input NGS	TAAGTGAATTTTTGTTTCAGCTAAAAG	Y	Y
Matched_reference_nucleotide	Reference nucleotide sequence of a given genomic region	aAAGTGAATTTTTGTTTCAGCTAAAAG	Y	N
Matched_read_count	The number of reads supporting the match	91	Y	Y
Matched_RPHM	Normalized read count supporting tha match	32.6392389935464	Y	Y
Proportion	Proportion of this annotation among all reads matching the input peptide sequence	0.947916666666666	Y	Y

target.tsv

This format is generated in target mode.

Column	Description	Example
Matched_location	Matched genomic location	chr16:84101848-84101874
Matched_mutations	Nucleotide variants including SNV and INDEL	chr16:84101848A>T
Matched_strand	RNA strand	-
Matched_peptide	Translated nucleotide sequence directly from the input NGS	LLAETKIHL
Matched_nucleotide	Nucleotide sequence directly from the input NGS	TAAGTGAATTTTTGTTTCAGCTAAAAG
Matched_reference_nucleotide	Reference nucleotide sequence of a given genomic region	aAAGTGAATTTTTGTTTCAGCTAAAAG
Matched_read_count	The number of reads supporting the match	91
Matched_RPHM	Normalized read count supporting tha match	32.6392389935464
Proportion	Proportion of this annotation among all reads matching the input peptide sequence	0.978494623655914

gloc.tsv

This format is generated in both scan and target modes. It summarizes matches at the genomic location level, regardless of mutations

Column	Description	Example	Scan mode	Target mode
Matched_peptide	Translated nucleotide sequence directly from the input NGS	LLAETKIHL	Y	Y
Matched_location	Matched genomic location	chr16:84101848-84101874	Y	Y
Matched_strand	RNA strand	-	Y	Y
Matched_read_count	The number of reads supporting the match regardless of mutations	93	Y	Y
Matched_RPHM	Normalized read count supporting tha match regradless of mutations	33.3565849054925	Y	Y
Proportion	Proportion of this annotation among all reads matching the input peptide sequence	0.96875	Y	Y

peptide.tsv

This format is generated in both scan and target modes. It summarizes matches at the peptide level.

Column	Description	Example	Scan mode	Target mode
Matched_peptide(sum)	Translated nucleotide sequence directly from the input NGS	LLAETKIHL	Y	Y
Abundant_location	The most abundant genomic location among all matched locations	chr16:84101848-84101874	Y	Y
Abundant_strand	RNA strand of the most abundant genomic location	-	Y	Y
Proportion	Proportion of this annotation among all reads matching the input peptide sequence	0.96875	Y	Y
Matched_num_locations	The number of matched genomic locations	2	Y	Y
Matched_read_count	Sum of the number of reads supporting the matches	96	Y	Y
Matched_RPHM	Normalized read count supporting tha sum of matches	34.4326037734116	Y	Y

annotate.tsv

This format is generated in annotate mode.

Column	Description	Example
Annotation_count	The number of possible annotations based on a given gene model	1
Gene_id	Gene id of a given genomic location	ENSG00000140943.18
Gene_name	Gene name of a given genomic location	MBTPS1
Gene_strand	Gene strand	-
Gene_type	Gene type	protein_coding
Class_code	It assigns events, detailed in below	5`-UTR
Unique_class_code	It only reports unique class code by removing duplications	5`-UTR
Warning_tag	It reports a warning if the gene annotation is incomplete	.

Class_code
-- In-frame (IF)
-- Out-of-frame (OOF)
-- Non-coding RNA (ncRNA)
-- 5`-untranslated-region (5`-UTR)
-- 3`-untranslated-region (3`-UTR)
-- Intron-retention (IR)
-- Antisense RNA (asRNA)
-- Intergenic-region (IGR)
-- Exon-skipping (ES)
-- Alternative-splicing-site (ASS)
-- Unknown

Figures for the reviewers

Figures in the paper can be generated using: 1) R code in figR folder, 2) Supplementary Tables 1,2,3, and 5, and 3) the meta dataset available at https://doi.org/10.5281/zenodo.17429717.

License

All code is available as under the Attribution-NonCommercial (CC BY-NC) 4.0 license.